{ "swagger": "2.0", "info": { "description": "MESA DNA Mutation Simulator - automated assessment of synthetic DNA\nfragments and simulation of DNA synthesis,\nstorage, sequencing, and PCR errors", "version": "1.2.3", "title": "MESA DNA Simulator", "termsOfService": "http://swagger.io/terms/", "contact": { "email": "peter.schwarz@uni-marburg.de" }, "license": { "name": "Apache 2.0", "url": "http://www.apache.org/licenses/LICENSE-2.0.html" } }, "host": "mesa.mosla.de", "basePath": "/", "tags": [ { "name": "API", "description": "API Description", "externalDocs": { "description": "Find out more", "url": "https://github.com/umr-ds/mesa_dna_sim.git" } } ], "schemes": [ "https" ], "paths": { "/api/homopolymer": { "post": { "tags": [ "error probs" ], "summary": "Calculate homopolymer error probabilities", "description": "", "parameters": [ { "in": "body", "name": "requestbody", "description": "Sequence and parameters to calculate the error probabilities with.", "required": true, "schema": { "$ref": "#/definitions/Requestbody_homopolymer" } } ], "responses": { "200": { "description": "Ok" }, "405": { "description": "Invalid input" }, "429": { "description": "Too Many Requests" } }, "security": [ { "api_key": [] } ] } }, "/api/gccontent": { "post": { "tags": [ "error probs" ], "summary": "Calculate error probabilities based on gc-content", "description": "", "parameters": [ { "in": "body", "name": "requestbody", "description": "Sequence and parameters to calculate the error probabilities with.", "required": true, "schema": { "$ref": "#/definitions/Requestbody_gccontent" } } ], "responses": { "200": { "description": "Ok" }, "405": { "description": "Invalid input" }, "429": { "description": "Too Many Requests" } }, "security": [ { "api_key": [] } ] } }, "/api/kmer": { "post": { "tags": [ "error probs" ], "summary": "Calculate error probabilities based on the occurence of kmers", "description": "", "parameters": [ { "in": "body", "name": "requestbody", "description": "Sequence and parameters to calculate the error probabilities with.", "required": true, "schema": { "$ref": "#/definitions/Requestbody_kmer" } } ], "responses": { "200": { "description": "Ok" }, "405": { "description": "Invalid input" }, "429": { "description": "Too Many Requests" } }, "security": [ { "api_key": [] } ] } }, "/api/subsequences": { "post": { "tags": [ "error probs" ], "summary": "Calculate error probabilities based on the occurence of subsequences", "description": "", "parameters": [ { "in": "body", "name": "requestbody", "description": "Sequence and undesired motifs to calculate the error probabilities with.", "required": true, "schema": { "$ref": "#/definitions/Requestbody_undesiredSeqs" } } ], "responses": { "200": { "description": "Ok" }, "405": { "description": "Invalid input" }, "429": { "description": "Too Many Requests" } }, "security": [ { "api_key": [] } ] } }, "/api/max_expect": { "post": { "tags": [ "max expect" ], "summary": "", "description": "", "parameters": [ { "in": "body", "name": "requestbody", "description": "", "required": true, "schema": { "$ref": "#/definitions/Requestbody_maxExpect" } } ], "responses": { "200": { "description": "Ok" }, "405": { "description": "Invalid input" }, "429": { "description": "Too Many Requests" } }, "security": [ { "api_key": [] } ] } }, "/api/getIMG": { "get": { "tags": [ "max expect" ], "summary": "", "description": "", "parameters": [ { "in": "query", "name": "id", "type": "integer" }, { "in": "query", "name": "type", "type": "string" } ], "responses": { "200": { "description": "Ok" }, "405": { "description": "Invalid input" }, "429": { "description": "Too Many Requests" } }, "security": [ { "api_key": [] } ] } }, "/api/all": { "post": { "tags": [ "complete calculation" ], "summary": "Takes a sequence and calculates all error probabilities", "description": "", "parameters": [ { "in": "body", "name": "requestbody", "description": "", "required": true, "schema": { "$ref": "#/definitions/Requestbody_all" } } ], "responses": { "200": { "description": "Ok" }, "405": { "description": "Invalid input" }, "429": { "description": "Too Many Requests" } }, "security": [ { "api_key": [] } ] } }, "/api/fasta_all": { "post": { "tags": [ "complete calculation" ], "summary": "Takes a list of sequences to calculate error probabilities for.", "description": "", "parameters": [ { "in": "body", "name": "requestbody", "description": "", "schema": { "type": "object" } } ], "responses": { "200": { "description": "Ok" }, "405": { "description": "Invalid input" }, "429": { "description": "Too Many Requests" } }, "security": [ { "api_key": [] } ] } } }, "securityDefinitions": { "api_key": { "type": "apiKey", "name": "key", "in": "header" } }, "definitions": { "Requestbody_homopolymer": { "type": "object", "properties": { "key": { "type": "string", "example": "TESTlKG-b6GTESTT7cgGTESTw_MRTESTj_e44wnTEST" }, "sequence": { "type": "string", "example": "AAAAAAAAAGGGGGGGGAAAAAAAAAA" }, "homopolymer_error_prob": { "$ref": "#/definitions/Error_prob" }, "asHTML": { "type": "boolean", "example": false } } }, "Requestbody_gccontent": { "type": "object", "properties": { "key": { "type": "string", "example": "TESTlKG-b6GTESTT7cgGTESTw_MRTESTj_e44wnTEST" }, "sequence": { "type": "string", "example": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA" }, "gc_error_prob": { "$ref": "#/definitions/Error_prob" }, "asHTML": { "type": "boolean", "example": false }, "gc_windowsize": { "type": "integer", "example": 15 } } }, "Requestbody_kmer": { "type": "object", "properties": { "key": { "type": "string", "example": "TESTlKG-b6GTESTT7cgGTESTw_MRTESTj_e44wnTEST" }, "sequence": { "type": "string", "example": "TTAATTGGGGGGGGTTAATTAATT" }, "kmer_error_prob": { "$ref": "#/definitions/Error_prob" }, "asHTML": { "type": "boolean", "example": false }, "kmer_windowsize": { "type": "integer", "example": 15 } } }, "Requestbody_undesiredSeqs": { "type": "object", "properties": { "key": { "type": "string", "example": "TESTlKG-b6GTESTT7cgGTESTw_MRTESTj_e44wnTEST" }, "sequence": { "type": "string", "example": "AAAATTTTGGGGCCCC" }, "enabledUndesiredSeqs": { "type": "array", "items": { "$ref": "#/definitions/EnabledSubsequences" } }, "asHTML": { "type": "boolean", "example": false } } }, "Requestbody_maxExpect": { "type": "object", "properties": { "key": { "type": "string", "example": "TESTlKG-b6GTESTT7cgGTESTw_MRTESTj_e44wnTEST" }, "retention_time": { "type": "integer", "example": 31536000, "description": "Retention time in seconds, maximum is 31536000 (1 year) - should be set to 0 for bulk API usage" }, "sequence": { "type": "string", "example": "AGACGTAGCATCAGCTACGATCAGCTATGCAGC" } } }, "Requestbody_all": { "type": "object", "properties": { "key": { "type": "string", "example": "TESTlKG-b6GTESTT7cgGTESTw_MRTESTj_e44wnTEST" }, "uuid": { "type": "string" }, "sequence": { "type": "string", "example": "AGACTACGATCACGACGTACGTATGCGACGTATGCAGCAGCTACGACG" }, "homopolymer_name": { "type": "string", "example": "Default Graph" }, "homopolymer_error_prob": { "$ref": "#/definitions/Error_prob" }, "gc_windowsize": { "type": "integer", "example": 15 }, "gc_name": { "type": "string", "example": "Default Graph" }, "gc_error_prob": { "$ref": "#/definitions/Error_prob" }, "kmer_windowssize": { "type": "integer", "example": 15 }, "kmer_name": { "type": "string", "example": "Default Graph" }, "kmer_error_prob": { "$ref": "#/definitions/Error_prob" }, "enabledUndesiredSeqs": { "type": "array", "items": { "$ref": "#/definitions/EnabledSubsequences" } }, "err_simulation_order": { "$ref": "#/definitions/Error_sim_order" }, "use_error_probs": { "type": "boolean", "example": false }, "acgt_only": { "type": "boolean", "example": true }, "random_seed": { "type": "string", "example": "" }, "do_max_expect": { "type": "boolean", "example": true }, "temperature": { "type": "number", "example": 310.15 }, "send_mail": { "type": "boolean", "example": false }, "email": { "type": "string", "example": "" }, "retention_time": { "type": "integer", "example": 31536000, "description": "Retention time in seconds, maximum is 31536000 (1 year) - should be set to 0 for bulk API usage" }, "asHTML": { "type": "boolean", "example": false } } }, "Requestbody_fasta_all": { "type": "object", "properties": { "key": { "type": "string", "example": "TESTlKG-b6GTESTT7cgGTESTw_MRTESTj_e44wnTEST" }, "uuid": { "type": "string" }, "sequences": { "type": "array", "items": { "type": "string", "example": [ "AAAGGACTAGCGATCGACGATG", "AGCATCGACTGACGAGTCGGAC", "ACGAGTGCATGCAGCATGCGAC" ] } } } }, "Error_sim_order": { "type": "object", "properties": { "Synthesis": { "type": "array", "items": { "$ref": "#/definitions/Error_meth" } }, "Storage/PCR": { "type": "array", "items": { "$ref": "#/definitions/Error_meth" } }, "Sequencing": { "type": "array", "items": { "$ref": "#/definitions/Error_meth" } } } }, "Error_meth": { "type": "object", "properties": { "name": { "type": "string", "example": "example_method" }, "id": { "type": "integer", "example": 14 }, "conf": { "$ref": "#/definitions/Error_conf" } } }, "Error_conf": { "type": "object", "properties": { "err_data": { "$ref": "#/definitions/Error_data" }, "err_attributes": { "$ref": "#/definitions/Error_attributes" }, "type": { "type": "string" } } }, "Error_data": { "type": "object", "properties": { "deletion": { "type": "number", "example": 0.3333 }, "insertion": { "type": "number", "example": 0.3333 }, "mismatch": { "type": "number", "example": 0.3334 }, "raw_rate": { "type": "number", "example": 0.0005 } } }, "Error_attributes": { "type": "object", "properties": { "deletion": { "$ref": "#/definitions/Error_attribute" }, "insertion": { "$ref": "#/definitions/Error_attribute" }, "mismatch": { "$ref": "#/definitions/Error_attribute_mismatch" } } }, "Error_attribute": { "type": "object", "properties": { "pattern": { "type": "object", "properties": { "A": { "type": "number", "example": 0.25 }, "C": { "type": "number", "example": 0.25 }, "G": { "type": "number", "example": 0.25 }, "T": { "type": "number", "example": 0.25 } } }, "position": { "type": "object", "properties": { "homopolymer": { "type": "number", "example": 0.5 }, "random": { "type": "number", "example": 0.5 } } } } }, "Error_attribute_mismatch": { "type": "object", "properties": { "pattern": { "type": "object", "properties": { "A": { "type": "object", "properties": { "C": { "type": "number", "example": 0 }, "G": { "type": "number", "example": 1 }, "T": { "type": "number", "example": 0 } } }, "C": { "type": "object", "properties": { "A": { "type": "number", "example": 0 }, "G": { "type": "number", "example": 0 }, "T": { "type": "number", "example": 1 } } }, "G": { "type": "object", "properties": { "A": { "type": "number", "example": 1 }, "C": { "type": "number", "example": 0 }, "T": { "type": "number", "example": 0 } } }, "T": { "type": "object", "properties": { "A": { "type": "number", "example": 0 }, "C": { "type": "number", "example": 1 }, "G": { "type": "number", "example": 0 } } } } } } }, "EnabledSubsequences": { "type": "object", "properties": { "sequence": { "type": "string", "example": "AAAA" }, "error_prob": { "type": "number", "example": 100 }, "enabled": { "type": "boolean", "example": true }, "description": { "type": "string", "example": "Random description" } } }, "Error_prob": { "type": "object", "properties": { "data": { "type": "array", "items": { "$ref": "#/definitions/Graph_point" }, "example": [ { "x": 0, "y": 0 }, { "x": 2, "y": 0 }, { "x": 4, "y": 20 }, { "x": 5, "y": 50 }, { "x": 6, "y": 80 }, { "x": 7, "y": 100 }, { "x": 20, "y": 100 } ] }, "interpolation": { "type": "boolean", "example": true }, "maxX": { "type": "integer", "example": 20 }, "maxY": { "type": "integer", "example": 100 }, "xRound": { "type": "integer", "example": 0 }, "yRound": { "type": "integer", "example": 2 }, "label": { "type": "string", "example": "Error Probability" }, "xLabel": { "type": "string", "example": "xLabel" } } }, "Graph_point": { "type": "object", "properties": { "x": { "type": "number" }, "y": { "type": "number" } } } }, "externalDocs": { "description": "", "url": "http://a.b" } }